Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.256239 |
Chromosome: | chromosome 12 |
Location: | 697107 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g494800 | DII1,IDA-IC28,IDA4,p28IDA4 | (1 of 1) K10410 - dynein light intermediate chain, axonemal (DNALI); Flagellar inner arm dynein light chain p28 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCGAATAATTACCTTTATCCAAACGCAC |
Internal bar code: | CGGGCACGGCGGGCGGATGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 357 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAACAGACTCGCCCAGAGC |
Suggested primer 2: | AGGTTGATAACATCCAGGCG |