Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.256250 |
Chromosome: | chromosome 2 |
Location: | 5723426 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g110150 | (1 of 1) PF00651//PF03110//PF07707 - BTB/POZ domain (BTB) // SBP domain (SBP) // BTB And C-terminal Kelch (BACK) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTCATGTCATCCTCGTTTAATCACGCCA |
Internal bar code: | AGAGGATGGGGGGGCGACGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 439 |
LEAP-Seq percent confirming: | 70.5882 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGTGGAACGTGTAGTTCA |
Suggested primer 2: | CCATGTATGACGACACAGCC |