Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.256282 |
Chromosome: | chromosome 2 |
Location: | 3473335 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095120 | ANK18 | Predicted protein with ankyrin repeats; (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACTGCCACAAGACTTGCTCAGATGGATA |
Internal bar code: | TGGGCTCAATACTCGCATCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 463 |
LEAP-Seq percent confirming: | 97.2222 |
LEAP-Seq n confirming: | 70 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACAGTGGGACCGTACAC |
Suggested primer 2: | ATGATACTGAAAAACGGCGG |