| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.256302 |
| Chromosome: | chromosome 12 |
| Location: | 1158813 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490050 | TPT18,GMT1,TPT19 | (1 of 3) K15356 - GDP-mannose transporter (VRG4, GONST1); Putative GDP-mannose transporter | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCCCTGTGGCGATGCCCCTGTCAAAGG |
| Internal bar code: | ATGCCTGTTCTCCCTTCTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 435 |
| LEAP-Seq percent confirming: | 99.7519 |
| LEAP-Seq n confirming: | 402 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACCAGCATCATCATTGG |
| Suggested primer 2: | ACCATCTACTCGCTCATCGG |