Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.256328 |
Chromosome: | chromosome 1 |
Location: | 1457900 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g007450 | (1 of 4) K15111 - solute carrier family 25 (mitochondrial S-adenosylmethionine transporter), member 26 (SLC25A26) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATTCGCTTTCCTATCGACCGATCACCGT |
Internal bar code: | GGGTCTGAGCATAACGCGGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 255 |
LEAP-Seq percent confirming: | 98.5294 |
LEAP-Seq n confirming: | 134 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCATAGTTTGGGGCAGTT |
Suggested primer 2: | TAGTGATGGTGGTGGTGGTG |