| Insertion cassette: | CIB1 | 
| Side of cassette: | 5' | 
| Strand: | - | 
| Strain: | LMJ.RY0402.256372 | 
| Chromosome: | scaffold 19 | 
| Location: | 71633 | 
| Confidence (%): | 95 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre19.g750547 | NDA2 | thylakoid NADH dehydrogenase; (1 of 3) K17871 - NADH:ubiquinone reductase (non-electrogenic) (ndh1) | intron | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATAACAAGCGGAGGTACTACACAAACAC | 
| Internal bar code: | TCTTTAGATGGACGGCTATCGT | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 277 | 
| LEAP-Seq percent confirming: | 100.0 | 
| LEAP-Seq n confirming: | 62 | 
| LEAP-Seq n nonconfirming: | 0 | 
| LEAP-Seq n unique pos: | 3 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAGGTTGGGGTAGAGCTT | 
| Suggested primer 2: | GCTCTGTGCAAGGACATTGA |