| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.256385 |
| Chromosome: | chromosome 6 |
| Location: | 6906571 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g295826 | (1 of 1) IPR002048//IPR007065 - EF-hand domain // HPP | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGTTGCTCACGACCGTGCCGCTGCCGC |
| Internal bar code: | TACAGCGAGCCCAGATAGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 28 |
| LEAP-Seq percent confirming: | 99.0654 |
| LEAP-Seq n confirming: | 106 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTCCTCCCTCGCCTAAG |
| Suggested primer 2: | GTTGATCCTAACCGGGGAAT |