Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.256405 |
Chromosome: | chromosome 10 |
Location: | 5054256 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g455750 | SRH19 | (1 of 3) K15710 - E3 ubiquitin-protein ligase SHPRH [EC:3.6.4.- 6.3.2.19] (SHPRH); SNF2-related DNA/RNA helicase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGAACCCGTTCCCCTGCCCACAAACTCG |
Internal bar code: | GGTCCTAAGCTCCTCAGGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 12 |
LEAP-Seq percent confirming: | 13.3333 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAAGGAGGAGGAGGAGGA |
Suggested primer 2: | CTTTGTTCCCCTGCATTCTC |