| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.256414 |
| Chromosome: | chromosome 9 |
| Location: | 2843308 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388650 | CYG29 | (1 of 11) 4.6.1.1//4.6.1.2 - Adenylate cyclase / ATP pyrophosphate-lyase // Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGAACAAGAATCCATCGCAAGGCAGGG |
| Internal bar code: | TGATGACGCGGCAACGGCAGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 248 |
| LEAP-Seq percent confirming: | 99.5192 |
| LEAP-Seq n confirming: | 414 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGTAGCACTCCGGGTCAC |
| Suggested primer 2: | CATGTGAGTCTGGCAGCATT |