| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.256424 |
| Chromosome: | chromosome 4 |
| Location: | 2135663 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219700 | BBS9 | (1 of 1) K19398 - Bardet-Biedl syndrome 9 protein (BBS9); Bardet-Biedl syndrome-9 associated protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCCAACAGTCAAGGGCTCATGGGGGCC |
| Internal bar code: | GTGTCCTGATAGAGGTAATCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 589 |
| LEAP-Seq percent confirming: | 99.6441 |
| LEAP-Seq n confirming: | 840 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTATCAGTTGCCCCCTGTG |
| Suggested primer 2: | GCACTTCAACGAGCTTTTCC |