| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.256567 |
| Chromosome: | chromosome 3 |
| Location: | 5206392 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182650 | PGA1 | Phospholipid/glycerol acyltransferase; (1 of 2) K13511 - monolysocardiolipin acyltransferase (TAZ) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCACGGCTACTTGTTGCTGCAGCAAAA |
| Internal bar code: | CCCGTACCAACTGGGGGAATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 536 |
| LEAP-Seq percent confirming: | 99.6246 |
| LEAP-Seq n confirming: | 1327 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCTGGACCAGTTTGACC |
| Suggested primer 2: | AGCAGGGACTCGTGTGTTCT |