| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.256576 |
| Chromosome: | chromosome 1 |
| Location: | 2222663 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012150 | FKB16-10,MSRA4 | Peptide methionine-S-sulfoxide reductase, msrA-type; (1 of 1) 1.8.4.11//5.2.1.8 - Peptide-methionine (S)-S-oxide reductase / Peptide methionine sulfoxide reductase // Peptidylprolyl isomerase / Rotamase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCTGACACCTCTTGTGCGAGAGCGCCC |
| Internal bar code: | ACGGCGGCGTAGGGAGCGAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 296 |
| LEAP-Seq percent confirming: | 98.8488 |
| LEAP-Seq n confirming: | 5925 |
| LEAP-Seq n nonconfirming: | 69 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTCGTCAGGCTCTTTCCA |
| Suggested primer 2: | ATGCGTGCCAAAACTAAACC |