Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.256749 |
Chromosome: | chromosome 6 |
Location: | 3770513 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278159 | CRCO,CO,CON1,CONSTANS | CONSTANS-like protein involved in circadian rhythms; (1 of 1) PF00643//PF06203 - B-box zinc finger (zf-B_box) // CCT motif (CCT) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCGGATTTGAGGAGTGGCATGACTACG |
Internal bar code: | CGGGACAATCGTGTCCTAACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 519 |
LEAP-Seq percent confirming: | 99.7847 |
LEAP-Seq n confirming: | 927 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCAGTACTTCCAGCAGCCT |
Suggested primer 2: | CACTATGGCTCTCTGCCCTC |