Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.256790 |
Chromosome: | chromosome 11 |
Location: | 3441933 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g481050 | (1 of 10) PF00505 - HMG (high mobility group) box (HMG_box); High mobility group protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGACTGATTGGCACCCCACTGCTGATTG |
Internal bar code: | CCTAGCACCAACAGGGGGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 607 |
LEAP-Seq percent confirming: | 88.9952 |
LEAP-Seq n confirming: | 744 |
LEAP-Seq n nonconfirming: | 92 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACAGACACTCGACGGATT |
Suggested primer 2: | CCTCACCCACCCAACTTCTA |