| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.256790 |
| Chromosome: | chromosome 11 |
| Location: | 3441933 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481050 | (1 of 10) PF00505 - HMG (high mobility group) box (HMG_box); High mobility group protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGACTGATTGGCACCCCACTGCTGATTG |
| Internal bar code: | CCTAGCACCAACAGGGGGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 607 |
| LEAP-Seq percent confirming: | 88.9952 |
| LEAP-Seq n confirming: | 744 |
| LEAP-Seq n nonconfirming: | 92 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACAGACACTCGACGGATT |
| Suggested primer 2: | CCTCACCCACCCAACTTCTA |