| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.256838 |
| Chromosome: | chromosome 13 |
| Location: | 125699 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g562800 | FAP337 | (1 of 1) PTHR22844//PTHR22844:SF191 - F-BOX AND WD40 DOMAIN PROTEIN // SUBFAMILY NOT NAMED; WD40-repeat Flagellar Associated Protein 337 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGGACGAGGCAGCGCTCACACACCTAC |
| Internal bar code: | GCTATTTGCCGTTGTTTGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 66 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 180 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCAGTACAACACCCATTC |
| Suggested primer 2: | GTCATCCTGACACGTCGTTG |