| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.256867 |
| Chromosome: | chromosome 7 |
| Location: | 3335481 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g334851 | HEP1,ZIM17 | (1 of 1) K17808 - mitochondrial protein import protein ZIM17 (ZIM17, DNLZ, Tim15); ZInc finger Motif protein of 17 kDa | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGGCAGCGCTAGCAGCAGCAACAGCGC |
| Internal bar code: | ACCGATAGAGGCGATCGGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 471 |
| LEAP-Seq percent confirming: | 92.093 |
| LEAP-Seq n confirming: | 396 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTTTACGTCGTGCAGCCT |
| Suggested primer 2: | ACCATTCTGGTACGACTGCC |