| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.256868 |
| Chromosome: | chromosome 9 |
| Location: | 1890262 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395450 | (1 of 9) PF01344 - Kelch motif (Kelch_1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGGGTAAGGCAGGCGGCACTGCAGCAT |
| Internal bar code: | GCAGCGAACATTTGTTGGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 910 |
| LEAP-Seq percent confirming: | 99.6049 |
| LEAP-Seq n confirming: | 12100 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAACTGAACGAGCAAGTA |
| Suggested primer 2: | CAGTCATCGCATTCCTGCTA |