Insertion junction: LMJ.RY0402.256889_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.256889
Chromosome:chromosome_13
Location:1616621
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein antisense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTAAGGATGTATGGCTTTAGAGCCAGGAAA
Internal bar code:AGTTAAAGGTTAGTCCAAGTAT

Confirmation - LEAP-Seq

LEAP-Seq distance:513
LEAP-Seq percent confirming:99.4048
LEAP-Seq n confirming:167
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:CACCACTCCGACGGTAACTT
Suggested primer 2:TGCATCTGCATGTGCTTACA