| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.256902 |
| Chromosome: | chromosome 12 |
| Location: | 3753410 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515050 | HLM18,SET4 | putative N-methyltransferase; (1 of 1) PTHR13793:SF5 - HISTONE-LYSINE N-METHYLTRANSFERASE ATX4-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGGATAAGCTGCTGCGCCTTCGGGCGC |
| Internal bar code: | CTACTCTGCTCGAGCCGGCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 98.6501 |
| LEAP-Seq n confirming: | 950 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCATCAGCCACGGGACTAC |
| Suggested primer 2: | TCCTCAACACACAAACGACC |