| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.256928 |
| Chromosome: | chromosome 17 |
| Location: | 1939967 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g710650 | PTK21 | (1 of 7) 2.7.10.2//2.7.12.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Dual-specificity kinase; Protein tyrosine kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGAATCGGTGCCTGCATCACATACTTA |
| Internal bar code: | GAAACTATGCCTTGTCAGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 808 |
| LEAP-Seq percent confirming: | 99.6393 |
| LEAP-Seq n confirming: | 1105 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGTCTTGAACGCCATTT |
| Suggested primer 2: | CGTGTGCATGTGTGATGGTA |