| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.256982 |
| Chromosome: | chromosome 3 |
| Location: | 7796964 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203100 | (1 of 1) IPR000253//IPR027417 - Forkhead-associated (FHA) domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTACGGTACGCCCCATTTGCGACACAACA |
| Internal bar code: | AAGGATCGATTTGCGTGCATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 328 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 325 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGACTCATTGATGGCAGC |
| Suggested primer 2: | GTCAACAACGGCATTGCTC |