| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.257049 |
| Chromosome: | chromosome 16 |
| Location: | 4725067 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686950 | CTF18 | DNA damage repair and chromosome cohesion protein; (1 of 1) K11269 - chromosome transmission fidelity protein 18 (CTF18, CHL12) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGCTCACGCCAACCCATGCTCACGCCA |
| Internal bar code: | GTGTTAGAGGCGGATAGCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 229 |
| LEAP-Seq percent confirming: | 99.7802 |
| LEAP-Seq n confirming: | 454 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCCTTGACAGCAGCAAC |
| Suggested primer 2: | CTCACATACCACGCATACCG |