| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.257076 |
| Chromosome: | chromosome 4 |
| Location: | 493549 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217930 | (1 of 1) PF06911 - Senescence-associated protein (Senescence) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACTGTAAGAGTGTGCACCGTGTGGCCAT |
| Internal bar code: | CGCGATAGCGTCCCGGGGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 52 |
| LEAP-Seq percent confirming: | 99.5816 |
| LEAP-Seq n confirming: | 2380 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGCTGGGTTGTAGAGGGT |
| Suggested primer 2: | GTGCAAAAGCTCAAGGAAGG |