| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.257176 |
| Chromosome: | chromosome 8 |
| Location: | 4243029 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g380650 | GT90-13,GT90F13 | GT90 family protein 13; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGTGGAAGCGGGGCTGCCCCCTTGGTC |
| Internal bar code: | GCATTTTGGATTCTGCTTTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 855 |
| LEAP-Seq percent confirming: | 99.4186 |
| LEAP-Seq n confirming: | 1710 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACAGCCAATACCGCAATC |
| Suggested primer 2: | ACCAAACTACCCTTCCACCC |