Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.257188 |
Chromosome: | chromosome 6 |
Location: | 8591490 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g308750 | (1 of 4) PF03006 - Haemolysin-III related (HlyIII) | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAAGGATCGGGTGTGCAGGGCTGCCATGC |
Internal bar code: | AGCTGGAGGCAAACGGTAGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 597 |
LEAP-Seq percent confirming: | 98.3051 |
LEAP-Seq n confirming: | 1102 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAGTATGGACTGGGCAGGG |
Suggested primer 2: | GCTGGTATGAGAGCAGGGAG |