| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.000005 |
| Chromosome: | chromosome 1 |
| Location: | 5334102 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037400 | CYN3,CYN19A,CYN19-1 | (1 of 2) K12868 - pre-mRNA-splicing factor SYF2 (SYF2); Cyclophilin 19-1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACAAAGAAACACACACTGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 656 |
| LEAP-Seq percent confirming: | 89.2157 |
| LEAP-Seq n confirming: | 91 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACATTGCGCAAAGACAGTG |
| Suggested primer 2: | AAAATGGAGAAGCACATCCG |