| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.000118 |
| Chromosome: | chromosome 1 |
| Location: | 4869225 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g033700 | (1 of 1) PF01933 - Uncharacterised protein family UPF0052 (UPF0052) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCACCACGCCACACCTCC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 838 |
| LEAP-Seq percent confirming: | 76.0563 |
| LEAP-Seq n confirming: | 108 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAGAGAAGGATGGTGACA |
| Suggested primer 2: | AAGAAGTGAAGGCGTAGCCA |