| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.000404 |
| Chromosome: | chromosome 10 |
| Location: | 3500746 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445050 | SLT3 | (1 of 1) IPR001898//IPR004680//IPR006037 - Sodium/sulphate symporter // Citrate transporter-like domain // Regulator of K+ conductance, C-terminal; Sodium/sulfate co-transporter 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTCCAGTACAGAGTCACC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1315 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 437 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGATCAGCTGCCACACTA |
| Suggested primer 2: | GTTTCCTTGTGCTCTCCAGC |