| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.000499 |
| Chromosome: | chromosome 9 |
| Location: | 6948046 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410500 | PAP11 | (1 of 1) IPR002934//IPR023214 - Polymerase, nucleotidyl transferase domain // HAD-like domain; Class-II RNA nucleotidyl transferase 11 | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTCACTTGGGTGGGTCG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 582 |
| LEAP-Seq percent confirming: | 70.4641 |
| LEAP-Seq n confirming: | 167 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | AGCAGCTCCGTCTTGATGAT |