| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.000957 |
| Chromosome: | chromosome 1 |
| Location: | 7522187 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g054150 | NTRC1,NTR4 | (1 of 1) PTHR10438//PTHR22912//PTHR22912:SF48 - THIOREDOXIN // DISULFIDE OXIDOREDUCTASE // NADPH-DEPENDENT THIOREDOXIN REDUCTASE 3; NADPH-dependent thioredoxin reductase C, chloroplastic | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTCAAAGGTCTCCGGCGT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 600 |
| LEAP-Seq percent confirming: | 78.2609 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTCTGGGCTAGTGCAAC |
| Suggested primer 2: | TGGGAAGCAAGGATCAAGAC |