| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.001135 |
| Chromosome: | chromosome 16 |
| Location: | 4833660 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686200 | TSPSP2,TPT1,TPS3,TSSP2 | (1 of 2) K16055 - trehalose 6-phosphate synthase/phosphatase (TPS); Triose-phosphTrehalose-6-phosphate synthase/phosphataseate transporter, class II | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCCTGCCCCAACCCCGCC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1067 |
| LEAP-Seq percent confirming: | 97.6744 |
| LEAP-Seq n confirming: | 168 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCAATGAACACGCAGCAG |
| Suggested primer 2: | CGGTTTAGTTTGGGCTGGTA |