Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.SG0182.001207 |
Chromosome: | chromosome 10 |
Location: | 3207273 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g442650 | (1 of 1) PTHR10887:SF366 - DNA-BINDING PROTEIN-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCACGGGCGTCGAGGCCCA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 574 |
LEAP-Seq percent confirming: | 99.115 |
LEAP-Seq n confirming: | 112 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGTGCTGGACTTCATTGG |
Suggested primer 2: | CGTTGGCCAGTTTCTCTAGC |