Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.001238 |
Chromosome: | chromosome 12 |
Location: | 7997601 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g552001 | (1 of 4) PF01435 - Peptidase family M48 (Peptidase_M48) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCCTGCACCTATGCAACTA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1079 |
LEAP-Seq percent confirming: | 90.9804 |
LEAP-Seq n confirming: | 464 |
LEAP-Seq n nonconfirming: | 46 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCGACAAGACCTCACAAAG |
Suggested primer 2: | GGAATATGCCTTGCTTGGAA |