| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.001245 |
| Chromosome: | chromosome 11 |
| Location: | 3412296 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480750 | (1 of 1) 3.4.19.5//3.5.1.1 - Beta-aspartyl-peptidase // Asparaginase / L-asparagine amidohydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATAGGGTCACCCAATGCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 792 |
| LEAP-Seq percent confirming: | 76.1773 |
| LEAP-Seq n confirming: | 275 |
| LEAP-Seq n nonconfirming: | 86 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGGTCTGTGGTGTGGTAG |
| Suggested primer 2: | CACACCTCCCTACCCTTTGA |