Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.001541 |
Chromosome: | chromosome 10 |
Location: | 4013754 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g449050 | (1 of 3) 2.4.1.68 - Glycoprotein 6-alpha-L-fucosyltransferase / Guanosine diphosphofucose-glycoprotein fucosyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCTGAGGGGCAGGGCACA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1164 |
LEAP-Seq percent confirming: | 98.6616 |
LEAP-Seq n confirming: | 516 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGGAGTCGCTGTGCTTCT |
Suggested primer 2: | GTTGGTATACGCAGCACCCT |