| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.001679 |
| Chromosome: | chromosome 7 |
| Location: | 5570475 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g351600 | HEL40 | (1 of 2) PTHR24031:SF303 - DEAD-BOX ATP-DEPENDENT RNA HELICASE 47, MITOCHONDRIAL; possible helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCACCAGCATCAAGCAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1414 |
| LEAP-Seq percent confirming: | 87.4074 |
| LEAP-Seq n confirming: | 118 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCAGCATTCGTGGTTCA |
| Suggested primer 2: | TGATGCAAACAACTTCCTGC |