| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.001692 |
| Chromosome: | chromosome 7 |
| Location: | 793806 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318200 | CGLD34 | (1 of 2) IPR001214//IPR019734 - SET domain // Tetratricopeptide repeat; histone methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGCACGAAGCCCAGACG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1272 |
| LEAP-Seq percent confirming: | 99.8936 |
| LEAP-Seq n confirming: | 939 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTACGCTGCCCTCAAGAC |
| Suggested primer 2: | ATGTCCTGTTCTCCCTGGTG |