| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.001755 |
| Chromosome: | chromosome 7 |
| Location: | 2849835 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g332100 | (1 of 2) 1.3.3.5 - Bilirubin oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTTCTCGGCACGTTCCTTC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1378 |
| LEAP-Seq percent confirming: | 99.9624 |
| LEAP-Seq n confirming: | 2662 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTACATGCTGTCATGGG |
| Suggested primer 2: | AAGGAGCGTGGTTTCTCTGA |