| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.002127 |
| Chromosome: | chromosome 16 |
| Location: | 6318515 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g674500 | ABCA4 | ABC transporter 4; (1 of 14) 3.6.3.25 - Sulfate-transporting ATPase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAGTAAGCAATCAAATGCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 531 |
| LEAP-Seq percent confirming: | 97.2171 |
| LEAP-Seq n confirming: | 524 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTAGGCGTGGTAAGCGT |
| Suggested primer 2: | CGGCTCTACAGCTCTCTGCT |