| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.002300 |
| Chromosome: | chromosome 3 |
| Location: | 7713318 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203550 | GT90-3,GT90F3 | GT90 family protein 3; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTACTTAGTCGGCGGGATT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 748 |
| LEAP-Seq percent confirming: | 71.1864 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATACCCACCATTTTACCG |
| Suggested primer 2: | GACGGTTAGTTCCCACTGGA |