Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.002369 |
Chromosome: | chromosome 4 |
Location: | 3227896 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g226550 | ARS11 | Arylsulfatase; (1 of 19) 3.1.6.1 - Arylsulfatase / Sulfatase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCTATAGTTCATGCTCT |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1363 |
LEAP-Seq percent confirming: | 99.1405 |
LEAP-Seq n confirming: | 1961 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCATCATAAACACTGGCGTG |
Suggested primer 2: | TTGTTGTTTCCTTCCTTGCC |