| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.002373 |
| Chromosome: | chromosome 12 |
| Location: | 2702360 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g503750 | FMO14 | (1 of 5) 1.14.13.114 - 6-hydroxynicotinate 3-monooxygenase / HNA-3-monooxygenase; Flavin-containing monooxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGAGCAGTGGCAGTTGAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 747 |
| LEAP-Seq percent confirming: | 92.3729 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACGAGTGTAACCCCCTTC |
| Suggested primer 2: | CACAAGGAGAGGTAGCCGAG |