| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.002432 |
| Chromosome: | chromosome 12 |
| Location: | 2371894 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g507400 | LCS3,CGL105 | (1 of 4) K01897 - long-chain acyl-CoA synthetase (ACSL, fadD); Long-chain acyl-CoA synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCAGTGATGCTGCAAGTA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 594 |
| LEAP-Seq percent confirming: | 80.8511 |
| LEAP-Seq n confirming: | 76 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACAACACGTGCGTAGCTC |
| Suggested primer 2: | GAGTTAGATTCCGCGTGCTC |