| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.002520 |
| Chromosome: | chromosome 16 |
| Location: | 5743909 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g678700 | (1 of 133) IPR012336 - Thioredoxin-like fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCATGTACAATAGCCTAC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 554 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCTTTGCATGCGAGTGT |
| Suggested primer 2: | TCATCCGTGTGTCAGAGGAC |