| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.002527 |
| Chromosome: | chromosome 1 |
| Location: | 6070303 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g043250 | (1 of 3) PTHR30570:SF0 - PHOSPHATE-BINDING PROTEIN PSTS | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTGCAAGGCTGTGATCAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1356 |
| LEAP-Seq percent confirming: | 95.6698 |
| LEAP-Seq n confirming: | 707 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAGACATGAACACGGTGG |
| Suggested primer 2: | GGACTGGACACACCCAGACT |