| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.002643 |
| Chromosome: | chromosome 1 |
| Location: | 2613360 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015200 | PDE4 | (1 of 17) 3.1.4.53 - 3',5'-cyclic-AMP phosphodiesterase / cAMP-specific phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATAACAAGCCTCGTGCCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1416 |
| LEAP-Seq percent confirming: | 99.9536 |
| LEAP-Seq n confirming: | 2156 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATAATCAAAGGGAACCCCG |
| Suggested primer 2: | CTCCGTCATGCATGTACACC |