| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.002784 |
| Chromosome: | chromosome 10 |
| Location: | 2968615 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440550 | (1 of 14) PF13540 - Regulator of chromosome condensation (RCC1) repeat (RCC1_2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTGCGCGGCGTCATGAC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 532 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 330 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCCTGTCCACAACATCT |
| Suggested primer 2: | GGCTTCTGCCTTATCGACAC |