Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.SG0182.002904 |
Chromosome: | chromosome 5 |
Location: | 2565182 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g236050 | (1 of 2) IPR015097 - Lung surfactant protein D coiled-coil trimerisation | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGCGAGCTGACTGAGGAGC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 889 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 358 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTGACAGCTCAGATTGC |
Suggested primer 2: | GGCCTCACCGTGTATGACTT |