| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.003234 |
| Chromosome: | chromosome 16 |
| Location: | 5546606 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g680300 | (1 of 4) 2.3.1.43 - Phosphatidylcholine--sterol O-acyltransferase / Phospholipid--cholesterol acyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGTACCAGGCGCCCGCG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 662 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCACAGGTTCACAAACGG |
| Suggested primer 2: | ACGGTACATCTGGTGCTTCC |