| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.003395 |
| Chromosome: | chromosome 2 |
| Location: | 5655678 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g109650 | GSP1 | Gamete-specific plus 1; (1 of 2) IPR001356//IPR008422//IPR009057 - Homeobox domain // Homeobox KN domain // Homeodomain-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAACACCCACACCACCAGCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 682 |
| LEAP-Seq percent confirming: | 83.7209 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTGGTGGTGTTGGTGAG |
| Suggested primer 2: | TATGAGCTTGTGCGCGATAC |